Skip to product information
1 of 1

shc002

shc002

Solid High Cover Gel SHC002 – DAWN shc002 SHC002 MISSION Non-Mammalian shRNA Control TRC1 Non human or mouse shRNA CCGGCAACAAGATGAAGAGCACCAACTC- GAGTTGGTGCTCTTCATCTTGTTGTTTTT shc002 Tour-Maubourg, bendrik, Max Telaer, UC Beatz - SHC002 Find the latest releases here

shc002 shrna: Sigma MISSION SHC002 sequence: CAACAAGATGAAGAGCACCAA Treatment protocol, Cells were plated 24 hours before transduction with

Regular price 152.00 ₹ INR
Regular price Sale price 152.00 ₹ INR
Sale Sold out
View full details